Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2017568
End position: 2017591
Length: 24

DNA sequence
>NC_013929, from 2017568 to 2017591 (24 bp); Streptomyces scabiei 87.22 GGCCGCCGCCGCGGCCGTGGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2017512-2018510	Sequence	SCAB_17911 - hypothetical protein (Protein is coded in complementary strand; from 2018510 to 2017512)