Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 8474932
End position: 8474955
Length: 24

DNA sequence
>NC_013929, from 8474932 to 8474955 (24 bp); Streptomyces scabiei 87.22 CTTCGGCTTCCGCTTCCGCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 8474195-8475163	Sequence	SCAB_76661 - lipoprotein (Protein is coded in complementary strand; from 8475163 to 8474195)