Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 5312101
End position: 5312136
Length: 36

DNA sequence
>NC_013929, from 5312101 to 5312136 (36 bp); Streptomyces scabiei 87.22 GCTCTCCCGTCCGCTCTCCCCTCCGCTCGCCGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5312034-5312228	Sequence	SCAB_47372 - hypothetical protein (Protein is coded in complementary strand; from 5312228 to 5312034)