Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 1648084
End position: 1648107
Length: 24

DNA sequence
>NC_021218, from 1648084 to 1648107 (24 bp); Helicobacter pylori UM066 TCATCTTCATATTCTTCTTCATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1647703-1648368	Sequence	K751_08290 - hypothetical protein (Protein is coded in complementary strand; from 1648368 to 1647703)