Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 710850
End position: 710873
Length: 24

DNA sequence
>NC_021218, from 710850 to 710873 (24 bp); Helicobacter pylori UM066 AGGTTTGGGTTTTGGTTTAGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 710867-711205	Sequence	K751_03535 - hypothetical protein (Protein is coded in complementary strand; from 711205 to 710867)