Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 914182
End position: 914205
Length: 24

DNA sequence
>NC_021218, from 914182 to 914205 (24 bp); Helicobacter pylori UM066 AACAAAAACAACAAAAAAAACAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 913516-914253	Sequence	K751_04525 - hypothetical protein (Protein is coded in complementary strand; from 914253 to 913516)