Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 1184693
End position: 1184719
Length: 27

DNA sequence
>NC_021218, from 1184693 to 1184719 (27 bp); Helicobacter pylori UM066 CATCGCCCCCATCGCCCCCATCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1183741-1184823	Sequence	K751_05925 obgE GTPase CgtA (Protein is coded in complementary strand; from 1184823 to 1183741)