Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 1212793
End position: 1212819
Length: 27

DNA sequence
>NC_021218, from 1212793 to 1212819 (27 bp); Helicobacter pylori UM066 GATATTTGGGATATTGGGGATATTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1211588-1213159	Sequence	K751_06020 - mechanosensitive ion channel family protein (Protein is coded in complementary strand; from 1213159 to 1211588)