Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 655276
End position: 655305
Length: 30

DNA sequence
>NC_021218, from 655276 to 655305 (30 bp); Helicobacter pylori UM066 GCTTTTTTTAGCTTCTTCTAACTTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 652340-657733	Sequence	K751_03260 - cag pathogenicity island protein Y VirB10-like protein (Protein is coded in complementary strand; from 657733 to 652340)