Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 244147
End position: 244182
Length: 36

DNA sequence
>NC_021218, from 244147 to 244182 (36 bp); Helicobacter pylori UM066 TGTTTGGCTAATTCTTTGGCTAATTGTTCGGCTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 243697-244302	Sequence	K751_01325 pyrE orotate phosphoribosyltransferase (Protein is coded in complementary strand; from 244302 to 243697)