Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 762222
End position: 762257
Length: 36

DNA sequence
>NC_021218, from 762222 to 762257 (36 bp); Helicobacter pylori UM066 ATTTGCGCGATTTTTTGCGCGATTTTTTGCGCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 760656-762902	Sequence	K751_03740 - recombination and DNA strand exchange inhibitor protein (Protein is coded in complementary strand; from 762902 to 760656)