Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 936519
End position: 936554
Length: 36

DNA sequence
>NC_021218, from 936519 to 936554 (36 bp); Helicobacter pylori UM066 GCTTTTAATTCTGTGTTTAATTCTGTGTTTAATTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 935802-937088	Sequence	K751_04620 - type I restriction-modification system specificity subunit (Protein is coded in complementary strand; from 937088 to 935802)