Sequence retrieval

Genome: Helicobacter pylori UM066
Start position: 994424
End position: 994468
Length: 45

DNA sequence
>NC_021218, from 994424 to 994468 (45 bp); Helicobacter pylori UM066 ATTAATCTCATCTTTTTCAATCTCATCTTTTTTAACCTCATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 994416-997427	Sequence	K751_04950 - type I site-specific deoxyribonuclease (Protein is coded in complementary strand; from 997427 to 994416)