Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 759927
End position: 759950
Length: 24

DNA sequence
>NC_022440, from 759927 to 759950 (24 bp); Chlamydia pecorum W73 CCAGCAGCAGCACCCGCACCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 759684-760079	Sequence	CPE2_0658 rplL 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 760079 to 759684)