Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 26093
End position: 26119
Length: 27

DNA sequence
>NC_022440, from 26093 to 26119 (27 bp); Chlamydia pecorum W73 GAAATAGAAGAAAAAGAAGACATAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 23489-26116	Sequence	CPE2_0017 - hypothetical protein (Protein is coded in complementary strand; from 26116 to 23489)