Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 588293
End position: 588319
Length: 27

DNA sequence
>NC_022440, from 588293 to 588319 (27 bp); Chlamydia pecorum W73 ATCCTTGCTATCCTTGCTATCCTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 588162-589223	Sequence	CPE2_0542 - hypothetical protein (Protein is coded in complementary strand; from 589223 to 588162)