Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 613835
End position: 613861
Length: 27

DNA sequence
>NC_022440, from 613835 to 613861 (27 bp); Chlamydia pecorum W73 ACGATGTCCACGATGTCCATGATGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 612822-614021	Sequence	CPE2_0553 - phospholipase D family protein (Protein is coded in complementary strand; from 614021 to 612822)