Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 588292
End position: 588327
Length: 36

DNA sequence
>NC_022440, from 588292 to 588327 (36 bp); Chlamydia pecorum W73 GATCCTTGCTATCCTTGCTATCCTTGCTATCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 588162-589223	Sequence	CPE2_0542 - hypothetical protein (Protein is coded in complementary strand; from 589223 to 588162)