Sequence retrieval

Genome: Chlamydia pecorum W73
Start position: 382158
End position: 382202
Length: 45

DNA sequence
>NC_022440, from 382158 to 382202 (45 bp); Chlamydia pecorum W73 TTCTTTAGGTGAAGATTCTTTAGGTGAAGATTCTTTAGGTGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 381076-382725	Sequence	CPE2_0343 - hypothetical protein (Protein is coded in complementary strand; from 382725 to 381076)